Review



renilla luciferase plasmid prl-null  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Promega renilla luciferase plasmid prl-null
    (A-B) IFN-β and NF-κB promoter activities are downregulated in DF-1 TLR3 KO cells but can be rescued by exogenous expression of TLR3. DF-1 and DF-1 TLR3 KO cells were co-transfected with pLucter (100 ng) and pR-null (30 ng) plasmids (A) , or with pSI-chNFκB-Luc (50 ng) plasmid (B) together with different amounts (100, 200, 400 or 800 ng) of the plasmid expressing chTLR3-His. At 8 h pt the cells were transfected with 250 ng of Poly I:C, and harvested at 24 h after plasmid transfection. A control consisting in cells co-transfected with pLucter, pR-null and the empty pCDNA3, or with the pSI-chNFκB-Luc, and the empty pCDNA3 plasmid (800 ng) was included in each assay. The samples were analyzed by the dual <t>luciferase</t> assay kit. Each determination was carried out in duplicate, and the firefly luciferase expression level of each sample was normalized by <t>Renilla</t> values. Results are expressed as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not transfected with poly I:C. (C-D) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) (C) or with the plasmid pSI-chNFκB-Luc (50 ng) (D). At 8 h pt, cells were either treated with Poly I:C (20 µg) added directly to the culture medium or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase activity quantification. (E) DF-1 and DF-1 TLR3 KO cells were transfected with a siRNA specifically silencing the expression of MDA5 protein, or with a control siRNA. At 24 h pt, the cultures were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) and 8 h later cells were either treated with poly I:C (20μg) or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase assay. (F) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng). At 8 h pt, cells were transfected with 250 ng of Poly I:C and subsequently treated with BFA (50μM) or the vehicle DMSO 1 h later. The samples were harvested at 24 h after plasmid transfection and analyzed using the dual luciferase assay kit. In panels C-F values are presented as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not treated with Poly I:C. Bars indicate means ± standard deviations based on data of duplicate samples from three independent experiments. *, ** and *** indicate p values of <0.05, <0.01 and <0.001, respectively, as determined by unpaired Student’s test. ns, not significant.
    Renilla Luciferase Plasmid Prl Null, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+prl-null/pgl3+basic/bio_rxiv__2025__07__16__665101-365-1-5
    Average 90 stars, based on 1 article reviews
    renilla luciferase plasmid prl-null - by Bioz Stars, 2026-10
    90/100 stars

    Images

    1) Product Images from "Key role of TLR3 in type I IFN expression and apoptosis induction in IBDV-infected chicken fibroblast cells"

    Article Title: Key role of TLR3 in type I IFN expression and apoptosis induction in IBDV-infected chicken fibroblast cells

    Journal: bioRxiv

    doi: 10.1101/2025.07.16.665101

    (A-B) IFN-β and NF-κB promoter activities are downregulated in DF-1 TLR3 KO cells but can be rescued by exogenous expression of TLR3. DF-1 and DF-1 TLR3 KO cells were co-transfected with pLucter (100 ng) and pR-null (30 ng) plasmids (A) , or with pSI-chNFκB-Luc (50 ng) plasmid (B) together with different amounts (100, 200, 400 or 800 ng) of the plasmid expressing chTLR3-His. At 8 h pt the cells were transfected with 250 ng of Poly I:C, and harvested at 24 h after plasmid transfection. A control consisting in cells co-transfected with pLucter, pR-null and the empty pCDNA3, or with the pSI-chNFκB-Luc, and the empty pCDNA3 plasmid (800 ng) was included in each assay. The samples were analyzed by the dual luciferase assay kit. Each determination was carried out in duplicate, and the firefly luciferase expression level of each sample was normalized by Renilla values. Results are expressed as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not transfected with poly I:C. (C-D) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) (C) or with the plasmid pSI-chNFκB-Luc (50 ng) (D). At 8 h pt, cells were either treated with Poly I:C (20 µg) added directly to the culture medium or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase activity quantification. (E) DF-1 and DF-1 TLR3 KO cells were transfected with a siRNA specifically silencing the expression of MDA5 protein, or with a control siRNA. At 24 h pt, the cultures were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) and 8 h later cells were either treated with poly I:C (20μg) or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase assay. (F) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng). At 8 h pt, cells were transfected with 250 ng of Poly I:C and subsequently treated with BFA (50μM) or the vehicle DMSO 1 h later. The samples were harvested at 24 h after plasmid transfection and analyzed using the dual luciferase assay kit. In panels C-F values are presented as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not treated with Poly I:C. Bars indicate means ± standard deviations based on data of duplicate samples from three independent experiments. *, ** and *** indicate p values of <0.05, <0.01 and <0.001, respectively, as determined by unpaired Student’s test. ns, not significant.
    Figure Legend Snippet: (A-B) IFN-β and NF-κB promoter activities are downregulated in DF-1 TLR3 KO cells but can be rescued by exogenous expression of TLR3. DF-1 and DF-1 TLR3 KO cells were co-transfected with pLucter (100 ng) and pR-null (30 ng) plasmids (A) , or with pSI-chNFκB-Luc (50 ng) plasmid (B) together with different amounts (100, 200, 400 or 800 ng) of the plasmid expressing chTLR3-His. At 8 h pt the cells were transfected with 250 ng of Poly I:C, and harvested at 24 h after plasmid transfection. A control consisting in cells co-transfected with pLucter, pR-null and the empty pCDNA3, or with the pSI-chNFκB-Luc, and the empty pCDNA3 plasmid (800 ng) was included in each assay. The samples were analyzed by the dual luciferase assay kit. Each determination was carried out in duplicate, and the firefly luciferase expression level of each sample was normalized by Renilla values. Results are expressed as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not transfected with poly I:C. (C-D) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) (C) or with the plasmid pSI-chNFκB-Luc (50 ng) (D). At 8 h pt, cells were either treated with Poly I:C (20 µg) added directly to the culture medium or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase activity quantification. (E) DF-1 and DF-1 TLR3 KO cells were transfected with a siRNA specifically silencing the expression of MDA5 protein, or with a control siRNA. At 24 h pt, the cultures were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) and 8 h later cells were either treated with poly I:C (20μg) or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase assay. (F) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng). At 8 h pt, cells were transfected with 250 ng of Poly I:C and subsequently treated with BFA (50μM) or the vehicle DMSO 1 h later. The samples were harvested at 24 h after plasmid transfection and analyzed using the dual luciferase assay kit. In panels C-F values are presented as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not treated with Poly I:C. Bars indicate means ± standard deviations based on data of duplicate samples from three independent experiments. *, ** and *** indicate p values of <0.05, <0.01 and <0.001, respectively, as determined by unpaired Student’s test. ns, not significant.

    Techniques Used: Expressing, Transfection, Plasmid Preparation, Control, Luciferase, Activity Assay

    Related Articles

    other:

    Article Title: Nipah virus W protein harnesses nuclear 14-3-3 to inhibit NF-κB-induced proinflammatory response
    Article Snippet: Plasmid pRL-Null (Promega TM , Cat# PR-E2271) was used as a Renilla luciferase expressing plasmid to normalize transfection efficiency.

    Article Title: Peptide protein translation inhibitor and the use thereof for protein translation control
    Article Snippet: The plasmid pRL-Null (Promega) digested with XbaI is linked to hybridised oligos in order to obtain the plasmid pRLuc-XbI.

    Article Title: Platinum IV complex inhibitor
    Article Snippet: The plasmid, pRLSRE, contains two copies of the serum response element (SRE) from the c-fos promoter (11, 43), subcloned into the renilla luciferase reporter, pRL-null (Promega, Madison, Wis.).

    Article Title: Cloning, characterization and analysis of the 5' regulatory region of zebrafish xpd gene.
    Article Snippet: 19 20 21 22 23 24 25 26 27 28 29 30 Article history: Received 17 December 2014 Received in revised form 24 March 2015 Accepted 1 April 2015 Available online xxxx

    Article Title: The DNA Virus White Spot Syndrome Virus Uses an Internal Ribosome Entry Site for Translation of the Highly Expressed Nonstructural Protein ICP35
    Article Snippet: Basically, the firefly luciferase (FL) from plasmid pGL3 (Promega) was inserted into the pRL-null plasmid (Promega) to give the dual-luciferase plasmid T7/ pRL-FL (7), but before transient DNA transfection in Spodoptera frugiperda Sf9 cells, the T7 promoter was replaced by the WSSV ie1 promoter (positions 94 to 52) (23).

    Luciferase:

    Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants
    Article Snippet: The resulting plant transformation vectors are summarized in table 5: TABLE 5 Plant expression vectors for A. thaliana transformation Composition of the expression cassette SEQ plant expression Promoter::SEQ ID NO::reporter ID vector gene::terminator NO LJK132 p-AtNit1::-::c-LUC::t-nos LJK133 p-AtNit1::SEQ ID NO1::c-LUC::t-nos 61 LJK91 p-AtNit1::SEQ ID NO7::c-LUC::t-nos LJK92 p-AtNit1::SEQ ID NO10::c-LUC::t-nos LJK94 p-AtNit1::SEQ ID NO12::c-LUC::t-nos LJK95 p-AtNit1::SEQ ID NO3::c-LUC::t-nos LJK97 p-AtNit1::SEQ ID NO13::c-LUC::t-nos LJK98 p-AtNit1::SEQ ID NO5::c-LUC::t-nos LJK99 p-AtNit1::SEQ ID NO14::c-LUC::t-nos LJK102 p-AtNit1::SEQ ID NO15::c-LUC::t-nos LJK103 p-AtNit1::SEQ ID NO16::c-LUC::t-nos LJK104 p-AtNit1::SEQ ID NO6::c-LUC::t-nos LJK105 p-AtNit1::SEQ ID NO11::c-LUC::t-nos LJK107 p-AtNit1::SEQ ID NO9::c-LUC::t-nos LJK108 p-AtNit1::SEQ ID NO2::c-LUC::t-nos LJK109 p-AtNit1::SEQ ID NO4::c-LUC::t-nos LJK110 p-AtNit1::SEQ ID NO17::c-LUC::t-nos LJK112 p-AtNit1::SEQ ID NO8::c-LUC::t-nos LJK113 p-AtNit1::SEQ ID NO18::c-LUC::t-nos LJK114 p-AtNit1::SEQ ID NO19::c-LUC::t-nos The resulting vectors were subsequently used to transform A. thaliana leaf protoplasts transiently. .. 1.3.2 Renilla luciferase Control Construct Renilla luciferase cDNA was amplified using 10 ng of the plasmid pRL-null from Promega (Madison, Wis., USA) as DNA template and primers R-LUC_for and R-LUC_rev (Table 6) with PCR parameters as described above. .. TABLE 6 Primer sequences (c-RLUC) Primer SEQ ID name Sequence NO RLUC_for aaaaaggtaccatgacttcgaaagtttatgatc 62 RLUC_rev aaattgagctcttattgttcatttttgagaactc 63 Following a DNA restriction digest with KpnI (10 U/microl) and SacI (10 U/microl) restriction endonuclease, the digested products were again purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: A Tcf/Lef element within the enhancer region of the human NANOG gene plays a role in promoter activation.
    Article Snippet: Article history: Received 31 May 2011 Available online 13 June 2011

    Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants
    Article Snippet: .. 1.3.2 Renilla Luciferase Control Construct Renilla luciferase cDNA was amplified using 10 ng of the plasmid pRL-null from Promega (Madison, WI, USA) as DNA template and primers R-LUC_for and R-LUC_rev (Table 6) with PCR parameters as described above. .. TABLE 6 Primer sequences (c-RLUC) Primer SEQ name Sequence ID NO RLUC_for aaaaaggtaccatgacttcgaaagttt 62 atgatc RLUC_rev aaattgagctcttattgttcatttttg 63 agaactc Following a DNA restriction digest with Kpn/(10 U/microl) and Sac/(10 U/microl) restriction endonuclease, the digested products were again purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany).

    Control:

    Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants
    Article Snippet: The resulting plant transformation vectors are summarized in table 5: TABLE 5 Plant expression vectors for A. thaliana transformation Composition of the expression cassette SEQ plant expression Promoter::SEQ ID NO::reporter ID vector gene::terminator NO LJK132 p-AtNit1::-::c-LUC::t-nos LJK133 p-AtNit1::SEQ ID NO1::c-LUC::t-nos 61 LJK91 p-AtNit1::SEQ ID NO7::c-LUC::t-nos LJK92 p-AtNit1::SEQ ID NO10::c-LUC::t-nos LJK94 p-AtNit1::SEQ ID NO12::c-LUC::t-nos LJK95 p-AtNit1::SEQ ID NO3::c-LUC::t-nos LJK97 p-AtNit1::SEQ ID NO13::c-LUC::t-nos LJK98 p-AtNit1::SEQ ID NO5::c-LUC::t-nos LJK99 p-AtNit1::SEQ ID NO14::c-LUC::t-nos LJK102 p-AtNit1::SEQ ID NO15::c-LUC::t-nos LJK103 p-AtNit1::SEQ ID NO16::c-LUC::t-nos LJK104 p-AtNit1::SEQ ID NO6::c-LUC::t-nos LJK105 p-AtNit1::SEQ ID NO11::c-LUC::t-nos LJK107 p-AtNit1::SEQ ID NO9::c-LUC::t-nos LJK108 p-AtNit1::SEQ ID NO2::c-LUC::t-nos LJK109 p-AtNit1::SEQ ID NO4::c-LUC::t-nos LJK110 p-AtNit1::SEQ ID NO17::c-LUC::t-nos LJK112 p-AtNit1::SEQ ID NO8::c-LUC::t-nos LJK113 p-AtNit1::SEQ ID NO18::c-LUC::t-nos LJK114 p-AtNit1::SEQ ID NO19::c-LUC::t-nos The resulting vectors were subsequently used to transform A. thaliana leaf protoplasts transiently. .. 1.3.2 Renilla luciferase Control Construct Renilla luciferase cDNA was amplified using 10 ng of the plasmid pRL-null from Promega (Madison, Wis., USA) as DNA template and primers R-LUC_for and R-LUC_rev (Table 6) with PCR parameters as described above. .. TABLE 6 Primer sequences (c-RLUC) Primer SEQ ID name Sequence NO RLUC_for aaaaaggtaccatgacttcgaaagtttatgatc 62 RLUC_rev aaattgagctcttattgttcatttttgagaactc 63 Following a DNA restriction digest with KpnI (10 U/microl) and SacI (10 U/microl) restriction endonuclease, the digested products were again purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants
    Article Snippet: .. 1.3.2 Renilla Luciferase Control Construct Renilla luciferase cDNA was amplified using 10 ng of the plasmid pRL-null from Promega (Madison, WI, USA) as DNA template and primers R-LUC_for and R-LUC_rev (Table 6) with PCR parameters as described above. .. TABLE 6 Primer sequences (c-RLUC) Primer SEQ name Sequence ID NO RLUC_for aaaaaggtaccatgacttcgaaagttt 62 atgatc RLUC_rev aaattgagctcttattgttcatttttg 63 agaactc Following a DNA restriction digest with Kpn/(10 U/microl) and Sac/(10 U/microl) restriction endonuclease, the digested products were again purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany).

    Construct:

    Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants
    Article Snippet: The resulting plant transformation vectors are summarized in table 5: TABLE 5 Plant expression vectors for A. thaliana transformation Composition of the expression cassette SEQ plant expression Promoter::SEQ ID NO::reporter ID vector gene::terminator NO LJK132 p-AtNit1::-::c-LUC::t-nos LJK133 p-AtNit1::SEQ ID NO1::c-LUC::t-nos 61 LJK91 p-AtNit1::SEQ ID NO7::c-LUC::t-nos LJK92 p-AtNit1::SEQ ID NO10::c-LUC::t-nos LJK94 p-AtNit1::SEQ ID NO12::c-LUC::t-nos LJK95 p-AtNit1::SEQ ID NO3::c-LUC::t-nos LJK97 p-AtNit1::SEQ ID NO13::c-LUC::t-nos LJK98 p-AtNit1::SEQ ID NO5::c-LUC::t-nos LJK99 p-AtNit1::SEQ ID NO14::c-LUC::t-nos LJK102 p-AtNit1::SEQ ID NO15::c-LUC::t-nos LJK103 p-AtNit1::SEQ ID NO16::c-LUC::t-nos LJK104 p-AtNit1::SEQ ID NO6::c-LUC::t-nos LJK105 p-AtNit1::SEQ ID NO11::c-LUC::t-nos LJK107 p-AtNit1::SEQ ID NO9::c-LUC::t-nos LJK108 p-AtNit1::SEQ ID NO2::c-LUC::t-nos LJK109 p-AtNit1::SEQ ID NO4::c-LUC::t-nos LJK110 p-AtNit1::SEQ ID NO17::c-LUC::t-nos LJK112 p-AtNit1::SEQ ID NO8::c-LUC::t-nos LJK113 p-AtNit1::SEQ ID NO18::c-LUC::t-nos LJK114 p-AtNit1::SEQ ID NO19::c-LUC::t-nos The resulting vectors were subsequently used to transform A. thaliana leaf protoplasts transiently. .. 1.3.2 Renilla luciferase Control Construct Renilla luciferase cDNA was amplified using 10 ng of the plasmid pRL-null from Promega (Madison, Wis., USA) as DNA template and primers R-LUC_for and R-LUC_rev (Table 6) with PCR parameters as described above. .. TABLE 6 Primer sequences (c-RLUC) Primer SEQ ID name Sequence NO RLUC_for aaaaaggtaccatgacttcgaaagtttatgatc 62 RLUC_rev aaattgagctcttattgttcatttttgagaactc 63 Following a DNA restriction digest with KpnI (10 U/microl) and SacI (10 U/microl) restriction endonuclease, the digested products were again purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants
    Article Snippet: .. 1.3.2 Renilla Luciferase Control Construct Renilla luciferase cDNA was amplified using 10 ng of the plasmid pRL-null from Promega (Madison, WI, USA) as DNA template and primers R-LUC_for and R-LUC_rev (Table 6) with PCR parameters as described above. .. TABLE 6 Primer sequences (c-RLUC) Primer SEQ name Sequence ID NO RLUC_for aaaaaggtaccatgacttcgaaagttt 62 atgatc RLUC_rev aaattgagctcttattgttcatttttg 63 agaactc Following a DNA restriction digest with Kpn/(10 U/microl) and Sac/(10 U/microl) restriction endonuclease, the digested products were again purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany).

    Amplification:

    Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants
    Article Snippet: The resulting plant transformation vectors are summarized in table 5: TABLE 5 Plant expression vectors for A. thaliana transformation Composition of the expression cassette SEQ plant expression Promoter::SEQ ID NO::reporter ID vector gene::terminator NO LJK132 p-AtNit1::-::c-LUC::t-nos LJK133 p-AtNit1::SEQ ID NO1::c-LUC::t-nos 61 LJK91 p-AtNit1::SEQ ID NO7::c-LUC::t-nos LJK92 p-AtNit1::SEQ ID NO10::c-LUC::t-nos LJK94 p-AtNit1::SEQ ID NO12::c-LUC::t-nos LJK95 p-AtNit1::SEQ ID NO3::c-LUC::t-nos LJK97 p-AtNit1::SEQ ID NO13::c-LUC::t-nos LJK98 p-AtNit1::SEQ ID NO5::c-LUC::t-nos LJK99 p-AtNit1::SEQ ID NO14::c-LUC::t-nos LJK102 p-AtNit1::SEQ ID NO15::c-LUC::t-nos LJK103 p-AtNit1::SEQ ID NO16::c-LUC::t-nos LJK104 p-AtNit1::SEQ ID NO6::c-LUC::t-nos LJK105 p-AtNit1::SEQ ID NO11::c-LUC::t-nos LJK107 p-AtNit1::SEQ ID NO9::c-LUC::t-nos LJK108 p-AtNit1::SEQ ID NO2::c-LUC::t-nos LJK109 p-AtNit1::SEQ ID NO4::c-LUC::t-nos LJK110 p-AtNit1::SEQ ID NO17::c-LUC::t-nos LJK112 p-AtNit1::SEQ ID NO8::c-LUC::t-nos LJK113 p-AtNit1::SEQ ID NO18::c-LUC::t-nos LJK114 p-AtNit1::SEQ ID NO19::c-LUC::t-nos The resulting vectors were subsequently used to transform A. thaliana leaf protoplasts transiently. .. 1.3.2 Renilla luciferase Control Construct Renilla luciferase cDNA was amplified using 10 ng of the plasmid pRL-null from Promega (Madison, Wis., USA) as DNA template and primers R-LUC_for and R-LUC_rev (Table 6) with PCR parameters as described above. .. TABLE 6 Primer sequences (c-RLUC) Primer SEQ ID name Sequence NO RLUC_for aaaaaggtaccatgacttcgaaagtttatgatc 62 RLUC_rev aaattgagctcttattgttcatttttgagaactc 63 Following a DNA restriction digest with KpnI (10 U/microl) and SacI (10 U/microl) restriction endonuclease, the digested products were again purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants
    Article Snippet: .. 1.3.2 Renilla Luciferase Control Construct Renilla luciferase cDNA was amplified using 10 ng of the plasmid pRL-null from Promega (Madison, WI, USA) as DNA template and primers R-LUC_for and R-LUC_rev (Table 6) with PCR parameters as described above. .. TABLE 6 Primer sequences (c-RLUC) Primer SEQ name Sequence ID NO RLUC_for aaaaaggtaccatgacttcgaaagttt 62 atgatc RLUC_rev aaattgagctcttattgttcatttttg 63 agaactc Following a DNA restriction digest with Kpn/(10 U/microl) and Sac/(10 U/microl) restriction endonuclease, the digested products were again purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany).

    Plasmid Preparation:

    Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants
    Article Snippet: The resulting plant transformation vectors are summarized in table 5: TABLE 5 Plant expression vectors for A. thaliana transformation Composition of the expression cassette SEQ plant expression Promoter::SEQ ID NO::reporter ID vector gene::terminator NO LJK132 p-AtNit1::-::c-LUC::t-nos LJK133 p-AtNit1::SEQ ID NO1::c-LUC::t-nos 61 LJK91 p-AtNit1::SEQ ID NO7::c-LUC::t-nos LJK92 p-AtNit1::SEQ ID NO10::c-LUC::t-nos LJK94 p-AtNit1::SEQ ID NO12::c-LUC::t-nos LJK95 p-AtNit1::SEQ ID NO3::c-LUC::t-nos LJK97 p-AtNit1::SEQ ID NO13::c-LUC::t-nos LJK98 p-AtNit1::SEQ ID NO5::c-LUC::t-nos LJK99 p-AtNit1::SEQ ID NO14::c-LUC::t-nos LJK102 p-AtNit1::SEQ ID NO15::c-LUC::t-nos LJK103 p-AtNit1::SEQ ID NO16::c-LUC::t-nos LJK104 p-AtNit1::SEQ ID NO6::c-LUC::t-nos LJK105 p-AtNit1::SEQ ID NO11::c-LUC::t-nos LJK107 p-AtNit1::SEQ ID NO9::c-LUC::t-nos LJK108 p-AtNit1::SEQ ID NO2::c-LUC::t-nos LJK109 p-AtNit1::SEQ ID NO4::c-LUC::t-nos LJK110 p-AtNit1::SEQ ID NO17::c-LUC::t-nos LJK112 p-AtNit1::SEQ ID NO8::c-LUC::t-nos LJK113 p-AtNit1::SEQ ID NO18::c-LUC::t-nos LJK114 p-AtNit1::SEQ ID NO19::c-LUC::t-nos The resulting vectors were subsequently used to transform A. thaliana leaf protoplasts transiently. .. 1.3.2 Renilla luciferase Control Construct Renilla luciferase cDNA was amplified using 10 ng of the plasmid pRL-null from Promega (Madison, Wis., USA) as DNA template and primers R-LUC_for and R-LUC_rev (Table 6) with PCR parameters as described above. .. TABLE 6 Primer sequences (c-RLUC) Primer SEQ ID name Sequence NO RLUC_for aaaaaggtaccatgacttcgaaagtttatgatc 62 RLUC_rev aaattgagctcttattgttcatttttgagaactc 63 Following a DNA restriction digest with KpnI (10 U/microl) and SacI (10 U/microl) restriction endonuclease, the digested products were again purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: A Tcf/Lef element within the enhancer region of the human NANOG gene plays a role in promoter activation.
    Article Snippet: Article history: Received 31 May 2011 Available online 13 June 2011

    Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants
    Article Snippet: .. 1.3.2 Renilla Luciferase Control Construct Renilla luciferase cDNA was amplified using 10 ng of the plasmid pRL-null from Promega (Madison, WI, USA) as DNA template and primers R-LUC_for and R-LUC_rev (Table 6) with PCR parameters as described above. .. TABLE 6 Primer sequences (c-RLUC) Primer SEQ name Sequence ID NO RLUC_for aaaaaggtaccatgacttcgaaagttt 62 atgatc RLUC_rev aaattgagctcttattgttcatttttg 63 agaactc Following a DNA restriction digest with Kpn/(10 U/microl) and Sac/(10 U/microl) restriction endonuclease, the digested products were again purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany).

    Polymerase Chain Reaction:

    Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants
    Article Snippet: The resulting plant transformation vectors are summarized in table 5: TABLE 5 Plant expression vectors for A. thaliana transformation Composition of the expression cassette SEQ plant expression Promoter::SEQ ID NO::reporter ID vector gene::terminator NO LJK132 p-AtNit1::-::c-LUC::t-nos LJK133 p-AtNit1::SEQ ID NO1::c-LUC::t-nos 61 LJK91 p-AtNit1::SEQ ID NO7::c-LUC::t-nos LJK92 p-AtNit1::SEQ ID NO10::c-LUC::t-nos LJK94 p-AtNit1::SEQ ID NO12::c-LUC::t-nos LJK95 p-AtNit1::SEQ ID NO3::c-LUC::t-nos LJK97 p-AtNit1::SEQ ID NO13::c-LUC::t-nos LJK98 p-AtNit1::SEQ ID NO5::c-LUC::t-nos LJK99 p-AtNit1::SEQ ID NO14::c-LUC::t-nos LJK102 p-AtNit1::SEQ ID NO15::c-LUC::t-nos LJK103 p-AtNit1::SEQ ID NO16::c-LUC::t-nos LJK104 p-AtNit1::SEQ ID NO6::c-LUC::t-nos LJK105 p-AtNit1::SEQ ID NO11::c-LUC::t-nos LJK107 p-AtNit1::SEQ ID NO9::c-LUC::t-nos LJK108 p-AtNit1::SEQ ID NO2::c-LUC::t-nos LJK109 p-AtNit1::SEQ ID NO4::c-LUC::t-nos LJK110 p-AtNit1::SEQ ID NO17::c-LUC::t-nos LJK112 p-AtNit1::SEQ ID NO8::c-LUC::t-nos LJK113 p-AtNit1::SEQ ID NO18::c-LUC::t-nos LJK114 p-AtNit1::SEQ ID NO19::c-LUC::t-nos The resulting vectors were subsequently used to transform A. thaliana leaf protoplasts transiently. .. 1.3.2 Renilla luciferase Control Construct Renilla luciferase cDNA was amplified using 10 ng of the plasmid pRL-null from Promega (Madison, Wis., USA) as DNA template and primers R-LUC_for and R-LUC_rev (Table 6) with PCR parameters as described above. .. TABLE 6 Primer sequences (c-RLUC) Primer SEQ ID name Sequence NO RLUC_for aaaaaggtaccatgacttcgaaagtttatgatc 62 RLUC_rev aaattgagctcttattgttcatttttgagaactc 63 Following a DNA restriction digest with KpnI (10 U/microl) and SacI (10 U/microl) restriction endonuclease, the digested products were again purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants
    Article Snippet: .. 1.3.2 Renilla Luciferase Control Construct Renilla luciferase cDNA was amplified using 10 ng of the plasmid pRL-null from Promega (Madison, WI, USA) as DNA template and primers R-LUC_for and R-LUC_rev (Table 6) with PCR parameters as described above. .. TABLE 6 Primer sequences (c-RLUC) Primer SEQ name Sequence ID NO RLUC_for aaaaaggtaccatgacttcgaaagttt 62 atgatc RLUC_rev aaattgagctcttattgttcatttttg 63 agaactc Following a DNA restriction digest with Kpn/(10 U/microl) and Sac/(10 U/microl) restriction endonuclease, the digested products were again purified with the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany).



    Similar Products

    renilla luciferase plasmid prl-null  (Promega)
    90
    Promega renilla luciferase plasmid prl-null
    (A-B) IFN-β and NF-κB promoter activities are downregulated in DF-1 TLR3 KO cells but can be rescued by exogenous expression of TLR3. DF-1 and DF-1 TLR3 KO cells were co-transfected with pLucter (100 ng) and pR-null (30 ng) plasmids (A) , or with pSI-chNFκB-Luc (50 ng) plasmid (B) together with different amounts (100, 200, 400 or 800 ng) of the plasmid expressing chTLR3-His. At 8 h pt the cells were transfected with 250 ng of Poly I:C, and harvested at 24 h after plasmid transfection. A control consisting in cells co-transfected with pLucter, pR-null and the empty pCDNA3, or with the pSI-chNFκB-Luc, and the empty pCDNA3 plasmid (800 ng) was included in each assay. The samples were analyzed by the dual <t>luciferase</t> assay kit. Each determination was carried out in duplicate, and the firefly luciferase expression level of each sample was normalized by <t>Renilla</t> values. Results are expressed as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not transfected with poly I:C. (C-D) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) (C) or with the plasmid pSI-chNFκB-Luc (50 ng) (D). At 8 h pt, cells were either treated with Poly I:C (20 µg) added directly to the culture medium or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase activity quantification. (E) DF-1 and DF-1 TLR3 KO cells were transfected with a siRNA specifically silencing the expression of MDA5 protein, or with a control siRNA. At 24 h pt, the cultures were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) and 8 h later cells were either treated with poly I:C (20μg) or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase assay. (F) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng). At 8 h pt, cells were transfected with 250 ng of Poly I:C and subsequently treated with BFA (50μM) or the vehicle DMSO 1 h later. The samples were harvested at 24 h after plasmid transfection and analyzed using the dual luciferase assay kit. In panels C-F values are presented as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not treated with Poly I:C. Bars indicate means ± standard deviations based on data of duplicate samples from three independent experiments. *, ** and *** indicate p values of <0.05, <0.01 and <0.001, respectively, as determined by unpaired Student’s test. ns, not significant.
    Renilla Luciferase Plasmid Prl Null, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+prl-null/pgl3+basic/bio_rxiv__2025__07__16__665101-365-1-5
    Average 90 stars, based on 1 article reviews
    renilla luciferase plasmid prl-null - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    plasmid prl-null  (Promega)
    90
    Promega plasmid prl-null
    (A-B) IFN-β and NF-κB promoter activities are downregulated in DF-1 TLR3 KO cells but can be rescued by exogenous expression of TLR3. DF-1 and DF-1 TLR3 KO cells were co-transfected with pLucter (100 ng) and pR-null (30 ng) plasmids (A) , or with pSI-chNFκB-Luc (50 ng) plasmid (B) together with different amounts (100, 200, 400 or 800 ng) of the plasmid expressing chTLR3-His. At 8 h pt the cells were transfected with 250 ng of Poly I:C, and harvested at 24 h after plasmid transfection. A control consisting in cells co-transfected with pLucter, pR-null and the empty pCDNA3, or with the pSI-chNFκB-Luc, and the empty pCDNA3 plasmid (800 ng) was included in each assay. The samples were analyzed by the dual <t>luciferase</t> assay kit. Each determination was carried out in duplicate, and the firefly luciferase expression level of each sample was normalized by <t>Renilla</t> values. Results are expressed as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not transfected with poly I:C. (C-D) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) (C) or with the plasmid pSI-chNFκB-Luc (50 ng) (D). At 8 h pt, cells were either treated with Poly I:C (20 µg) added directly to the culture medium or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase activity quantification. (E) DF-1 and DF-1 TLR3 KO cells were transfected with a siRNA specifically silencing the expression of MDA5 protein, or with a control siRNA. At 24 h pt, the cultures were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) and 8 h later cells were either treated with poly I:C (20μg) or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase assay. (F) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng). At 8 h pt, cells were transfected with 250 ng of Poly I:C and subsequently treated with BFA (50μM) or the vehicle DMSO 1 h later. The samples were harvested at 24 h after plasmid transfection and analyzed using the dual luciferase assay kit. In panels C-F values are presented as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not treated with Poly I:C. Bars indicate means ± standard deviations based on data of duplicate samples from three independent experiments. *, ** and *** indicate p values of <0.05, <0.01 and <0.001, respectively, as determined by unpaired Student’s test. ns, not significant.
    Plasmid Prl Null, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+prl-null/prl+null+plasmid/us12351807-427-15-18
    Average 90 stars, based on 1 article reviews
    plasmid prl-null - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    prl-null plasmid  (Promega)
    90
    Promega prl-null plasmid
    (A-B) IFN-β and NF-κB promoter activities are downregulated in DF-1 TLR3 KO cells but can be rescued by exogenous expression of TLR3. DF-1 and DF-1 TLR3 KO cells were co-transfected with pLucter (100 ng) and pR-null (30 ng) plasmids (A) , or with pSI-chNFκB-Luc (50 ng) plasmid (B) together with different amounts (100, 200, 400 or 800 ng) of the plasmid expressing chTLR3-His. At 8 h pt the cells were transfected with 250 ng of Poly I:C, and harvested at 24 h after plasmid transfection. A control consisting in cells co-transfected with pLucter, pR-null and the empty pCDNA3, or with the pSI-chNFκB-Luc, and the empty pCDNA3 plasmid (800 ng) was included in each assay. The samples were analyzed by the dual <t>luciferase</t> assay kit. Each determination was carried out in duplicate, and the firefly luciferase expression level of each sample was normalized by <t>Renilla</t> values. Results are expressed as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not transfected with poly I:C. (C-D) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) (C) or with the plasmid pSI-chNFκB-Luc (50 ng) (D). At 8 h pt, cells were either treated with Poly I:C (20 µg) added directly to the culture medium or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase activity quantification. (E) DF-1 and DF-1 TLR3 KO cells were transfected with a siRNA specifically silencing the expression of MDA5 protein, or with a control siRNA. At 24 h pt, the cultures were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) and 8 h later cells were either treated with poly I:C (20μg) or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase assay. (F) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng). At 8 h pt, cells were transfected with 250 ng of Poly I:C and subsequently treated with BFA (50μM) or the vehicle DMSO 1 h later. The samples were harvested at 24 h after plasmid transfection and analyzed using the dual luciferase assay kit. In panels C-F values are presented as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not treated with Poly I:C. Bars indicate means ± standard deviations based on data of duplicate samples from three independent experiments. *, ** and *** indicate p values of <0.05, <0.01 and <0.001, respectively, as determined by unpaired Student’s test. ns, not significant.
    Prl Null Plasmid, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+prl-null/prl+null+plasmid/pm39368754-102-23-27
    Average 90 stars, based on 1 article reviews
    prl-null plasmid - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    renilla luciferase expressing prl null plasmid  (Promega)
    90
    Promega renilla luciferase expressing prl null plasmid
    A , B WT and 4E KO MEF ( A ), or shScr and sh4EBP1/2 HEK293 cells ( B ) were grown in complete medium or glucose starved (Glc strv) for the indicated times, and analyzed by immunoblotting using antibodies against the indicated proteins. Representative results of two independent experiments are shown. C ShScr and sh4EBP1/2 HEK293 cells were grown in complete medium or glucose (Glc) starved for 16 h, and ACACA mRNA expression was analyzed by qRT-PCR. D ShScr and sh4EBP1/2 HEK293 cells were grown in complete medium or glucose (Glc) starved for 6 h, and translation efficiency (TE) of ACACA mRNA was calculated by measuring the levels of polysomal and total ACACA mRNA by qRT-PCR. n = 4 independent experiments. E , F WT and 4E KO MEF ( E ), or shScr and sh4EBP1/2 HEK293 cells ( F ) were transfected with an ACACA 5’UTR-containing Firefly <t>Luciferase</t> construct and a control <t>Renilla</t> Luciferase vector. Cells were grown in complete medium or glucose (Glc) starved for 6 h, and luminescence was measured. G HEK293 cells were transfected with an HA-tagged ACC1 expressing vector containing or not the ACACA 5’UTR. Cells were grown in complete medium or glucose starved (Glc strv) for the indicated times, and analyzed by immunoblotting using antibodies against the indicated proteins. Representative results of three independent experiments are shown. H , I 4E KO MEF ( H ) or sh4EBP1/2 HEK293 cells ( I ) were transfected with control siRNA (scr) or siRNAs targeting ACACA and grown in glucose starved medium (Glc strv) for 48 h. Cell death was measured by PI staining and flow cytometry. ACC1 protein levels were analyzed by immunoblotting. Data are shown as the mean ± SD. Statistics: unpaired one-sided Student’s t test ( C – F , H , I ); n = 3 independent experiments for ( C , E , F , H , I ). Source data are provided as a Source Data file.
    Renilla Luciferase Expressing Prl Null Plasmid, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+prl-null/pgl3+basic/pmc11094136-461-23-29
    Average 90 stars, based on 1 article reviews
    renilla luciferase expressing prl null plasmid - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    renilla luciferase prl null reporter plasmid  (Sartorius AG)
    86
    Sartorius AG renilla luciferase prl null reporter plasmid
    A , B WT and 4E KO MEF ( A ), or shScr and sh4EBP1/2 HEK293 cells ( B ) were grown in complete medium or glucose starved (Glc strv) for the indicated times, and analyzed by immunoblotting using antibodies against the indicated proteins. Representative results of two independent experiments are shown. C ShScr and sh4EBP1/2 HEK293 cells were grown in complete medium or glucose (Glc) starved for 16 h, and ACACA mRNA expression was analyzed by qRT-PCR. D ShScr and sh4EBP1/2 HEK293 cells were grown in complete medium or glucose (Glc) starved for 6 h, and translation efficiency (TE) of ACACA mRNA was calculated by measuring the levels of polysomal and total ACACA mRNA by qRT-PCR. n = 4 independent experiments. E , F WT and 4E KO MEF ( E ), or shScr and sh4EBP1/2 HEK293 cells ( F ) were transfected with an ACACA 5’UTR-containing Firefly <t>Luciferase</t> construct and a control <t>Renilla</t> Luciferase vector. Cells were grown in complete medium or glucose (Glc) starved for 6 h, and luminescence was measured. G HEK293 cells were transfected with an HA-tagged ACC1 expressing vector containing or not the ACACA 5’UTR. Cells were grown in complete medium or glucose starved (Glc strv) for the indicated times, and analyzed by immunoblotting using antibodies against the indicated proteins. Representative results of three independent experiments are shown. H , I 4E KO MEF ( H ) or sh4EBP1/2 HEK293 cells ( I ) were transfected with control siRNA (scr) or siRNAs targeting ACACA and grown in glucose starved medium (Glc strv) for 48 h. Cell death was measured by PI staining and flow cytometry. ACC1 protein levels were analyzed by immunoblotting. Data are shown as the mean ± SD. Statistics: unpaired one-sided Student’s t test ( C – F , H , I ); n = 3 independent experiments for ( C , E , F , H , I ). Source data are provided as a Source Data file.
    Renilla Luciferase Prl Null Reporter Plasmid, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+prl-null/pm38396960-539-25-35
    Average 86 stars, based on 1 article reviews
    renilla luciferase prl null reporter plasmid - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    renilla luciferase-expression plasmid (prl-null  (Promega)
    90
    Promega renilla luciferase-expression plasmid (prl-null
    A , B WT and 4E KO MEF ( A ), or shScr and sh4EBP1/2 HEK293 cells ( B ) were grown in complete medium or glucose starved (Glc strv) for the indicated times, and analyzed by immunoblotting using antibodies against the indicated proteins. Representative results of two independent experiments are shown. C ShScr and sh4EBP1/2 HEK293 cells were grown in complete medium or glucose (Glc) starved for 16 h, and ACACA mRNA expression was analyzed by qRT-PCR. D ShScr and sh4EBP1/2 HEK293 cells were grown in complete medium or glucose (Glc) starved for 6 h, and translation efficiency (TE) of ACACA mRNA was calculated by measuring the levels of polysomal and total ACACA mRNA by qRT-PCR. n = 4 independent experiments. E , F WT and 4E KO MEF ( E ), or shScr and sh4EBP1/2 HEK293 cells ( F ) were transfected with an ACACA 5’UTR-containing Firefly <t>Luciferase</t> construct and a control <t>Renilla</t> Luciferase vector. Cells were grown in complete medium or glucose (Glc) starved for 6 h, and luminescence was measured. G HEK293 cells were transfected with an HA-tagged ACC1 expressing vector containing or not the ACACA 5’UTR. Cells were grown in complete medium or glucose starved (Glc strv) for the indicated times, and analyzed by immunoblotting using antibodies against the indicated proteins. Representative results of three independent experiments are shown. H , I 4E KO MEF ( H ) or sh4EBP1/2 HEK293 cells ( I ) were transfected with control siRNA (scr) or siRNAs targeting ACACA and grown in glucose starved medium (Glc strv) for 48 h. Cell death was measured by PI staining and flow cytometry. ACC1 protein levels were analyzed by immunoblotting. Data are shown as the mean ± SD. Statistics: unpaired one-sided Student’s t test ( C – F , H , I ); n = 3 independent experiments for ( C , E , F , H , I ). Source data are provided as a Source Data file.
    Renilla Luciferase Expression Plasmid (Prl Null, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+prl-null/pgl3+basic/pmc09932814-140-44-51
    Average 90 stars, based on 1 article reviews
    renilla luciferase-expression plasmid (prl-null - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    (A-B) IFN-β and NF-κB promoter activities are downregulated in DF-1 TLR3 KO cells but can be rescued by exogenous expression of TLR3. DF-1 and DF-1 TLR3 KO cells were co-transfected with pLucter (100 ng) and pR-null (30 ng) plasmids (A) , or with pSI-chNFκB-Luc (50 ng) plasmid (B) together with different amounts (100, 200, 400 or 800 ng) of the plasmid expressing chTLR3-His. At 8 h pt the cells were transfected with 250 ng of Poly I:C, and harvested at 24 h after plasmid transfection. A control consisting in cells co-transfected with pLucter, pR-null and the empty pCDNA3, or with the pSI-chNFκB-Luc, and the empty pCDNA3 plasmid (800 ng) was included in each assay. The samples were analyzed by the dual luciferase assay kit. Each determination was carried out in duplicate, and the firefly luciferase expression level of each sample was normalized by Renilla values. Results are expressed as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not transfected with poly I:C. (C-D) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) (C) or with the plasmid pSI-chNFκB-Luc (50 ng) (D). At 8 h pt, cells were either treated with Poly I:C (20 µg) added directly to the culture medium or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase activity quantification. (E) DF-1 and DF-1 TLR3 KO cells were transfected with a siRNA specifically silencing the expression of MDA5 protein, or with a control siRNA. At 24 h pt, the cultures were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) and 8 h later cells were either treated with poly I:C (20μg) or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase assay. (F) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng). At 8 h pt, cells were transfected with 250 ng of Poly I:C and subsequently treated with BFA (50μM) or the vehicle DMSO 1 h later. The samples were harvested at 24 h after plasmid transfection and analyzed using the dual luciferase assay kit. In panels C-F values are presented as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not treated with Poly I:C. Bars indicate means ± standard deviations based on data of duplicate samples from three independent experiments. *, ** and *** indicate p values of <0.05, <0.01 and <0.001, respectively, as determined by unpaired Student’s test. ns, not significant.

    Journal: bioRxiv

    Article Title: Key role of TLR3 in type I IFN expression and apoptosis induction in IBDV-infected chicken fibroblast cells

    doi: 10.1101/2025.07.16.665101

    Figure Lengend Snippet: (A-B) IFN-β and NF-κB promoter activities are downregulated in DF-1 TLR3 KO cells but can be rescued by exogenous expression of TLR3. DF-1 and DF-1 TLR3 KO cells were co-transfected with pLucter (100 ng) and pR-null (30 ng) plasmids (A) , or with pSI-chNFκB-Luc (50 ng) plasmid (B) together with different amounts (100, 200, 400 or 800 ng) of the plasmid expressing chTLR3-His. At 8 h pt the cells were transfected with 250 ng of Poly I:C, and harvested at 24 h after plasmid transfection. A control consisting in cells co-transfected with pLucter, pR-null and the empty pCDNA3, or with the pSI-chNFκB-Luc, and the empty pCDNA3 plasmid (800 ng) was included in each assay. The samples were analyzed by the dual luciferase assay kit. Each determination was carried out in duplicate, and the firefly luciferase expression level of each sample was normalized by Renilla values. Results are expressed as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not transfected with poly I:C. (C-D) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) (C) or with the plasmid pSI-chNFκB-Luc (50 ng) (D). At 8 h pt, cells were either treated with Poly I:C (20 µg) added directly to the culture medium or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase activity quantification. (E) DF-1 and DF-1 TLR3 KO cells were transfected with a siRNA specifically silencing the expression of MDA5 protein, or with a control siRNA. At 24 h pt, the cultures were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng) and 8 h later cells were either treated with poly I:C (20μg) or transfected with increasing amounts (100, 200 and 300 ng) of Poly I:C. The samples were harvested at 24 h after plasmid transfection and used for luciferase assay. (F) DF-1 and DF-1 TLR3 KO cells were transfected with the plasmids pLucter (100 ng) and pR-null (30 ng). At 8 h pt, cells were transfected with 250 ng of Poly I:C and subsequently treated with BFA (50μM) or the vehicle DMSO 1 h later. The samples were harvested at 24 h after plasmid transfection and analyzed using the dual luciferase assay kit. In panels C-F values are presented as the fold induction over the level found in the control DF-1 or DF-1 TLR3 KO cells not treated with Poly I:C. Bars indicate means ± standard deviations based on data of duplicate samples from three independent experiments. *, ** and *** indicate p values of <0.05, <0.01 and <0.001, respectively, as determined by unpaired Student’s test. ns, not significant.

    Article Snippet: The Renilla luciferase plasmid (pRL-null; Promega) was kindly provided for Dr. Pablo Gastaminza.

    Techniques: Expressing, Transfection, Plasmid Preparation, Control, Luciferase, Activity Assay

    A , B WT and 4E KO MEF ( A ), or shScr and sh4EBP1/2 HEK293 cells ( B ) were grown in complete medium or glucose starved (Glc strv) for the indicated times, and analyzed by immunoblotting using antibodies against the indicated proteins. Representative results of two independent experiments are shown. C ShScr and sh4EBP1/2 HEK293 cells were grown in complete medium or glucose (Glc) starved for 16 h, and ACACA mRNA expression was analyzed by qRT-PCR. D ShScr and sh4EBP1/2 HEK293 cells were grown in complete medium or glucose (Glc) starved for 6 h, and translation efficiency (TE) of ACACA mRNA was calculated by measuring the levels of polysomal and total ACACA mRNA by qRT-PCR. n = 4 independent experiments. E , F WT and 4E KO MEF ( E ), or shScr and sh4EBP1/2 HEK293 cells ( F ) were transfected with an ACACA 5’UTR-containing Firefly Luciferase construct and a control Renilla Luciferase vector. Cells were grown in complete medium or glucose (Glc) starved for 6 h, and luminescence was measured. G HEK293 cells were transfected with an HA-tagged ACC1 expressing vector containing or not the ACACA 5’UTR. Cells were grown in complete medium or glucose starved (Glc strv) for the indicated times, and analyzed by immunoblotting using antibodies against the indicated proteins. Representative results of three independent experiments are shown. H , I 4E KO MEF ( H ) or sh4EBP1/2 HEK293 cells ( I ) were transfected with control siRNA (scr) or siRNAs targeting ACACA and grown in glucose starved medium (Glc strv) for 48 h. Cell death was measured by PI staining and flow cytometry. ACC1 protein levels were analyzed by immunoblotting. Data are shown as the mean ± SD. Statistics: unpaired one-sided Student’s t test ( C – F , H , I ); n = 3 independent experiments for ( C , E , F , H , I ). Source data are provided as a Source Data file.

    Journal: Nature Communications

    Article Title: mTORC1 regulates cell survival under glucose starvation through 4EBP1/2-mediated translational reprogramming of fatty acid metabolism

    doi: 10.1038/s41467-024-48386-y

    Figure Lengend Snippet: A , B WT and 4E KO MEF ( A ), or shScr and sh4EBP1/2 HEK293 cells ( B ) were grown in complete medium or glucose starved (Glc strv) for the indicated times, and analyzed by immunoblotting using antibodies against the indicated proteins. Representative results of two independent experiments are shown. C ShScr and sh4EBP1/2 HEK293 cells were grown in complete medium or glucose (Glc) starved for 16 h, and ACACA mRNA expression was analyzed by qRT-PCR. D ShScr and sh4EBP1/2 HEK293 cells were grown in complete medium or glucose (Glc) starved for 6 h, and translation efficiency (TE) of ACACA mRNA was calculated by measuring the levels of polysomal and total ACACA mRNA by qRT-PCR. n = 4 independent experiments. E , F WT and 4E KO MEF ( E ), or shScr and sh4EBP1/2 HEK293 cells ( F ) were transfected with an ACACA 5’UTR-containing Firefly Luciferase construct and a control Renilla Luciferase vector. Cells were grown in complete medium or glucose (Glc) starved for 6 h, and luminescence was measured. G HEK293 cells were transfected with an HA-tagged ACC1 expressing vector containing or not the ACACA 5’UTR. Cells were grown in complete medium or glucose starved (Glc strv) for the indicated times, and analyzed by immunoblotting using antibodies against the indicated proteins. Representative results of three independent experiments are shown. H , I 4E KO MEF ( H ) or sh4EBP1/2 HEK293 cells ( I ) were transfected with control siRNA (scr) or siRNAs targeting ACACA and grown in glucose starved medium (Glc strv) for 48 h. Cell death was measured by PI staining and flow cytometry. ACC1 protein levels were analyzed by immunoblotting. Data are shown as the mean ± SD. Statistics: unpaired one-sided Student’s t test ( C – F , H , I ); n = 3 independent experiments for ( C , E , F , H , I ). Source data are provided as a Source Data file.

    Article Snippet: For transfection, HEK293 cells were seeded in 12-well plates and transfected with 250 ng of each 5’UTR Firefly Luciferase reporter and 3 ng Renilla Luciferase expressing pRL null plasmid (Promega), completed to 500 ng DNA with pcDNA3.1 plasmid, using CalFectin transfection reagent (Signagen) according to the manufacturer’s guidelines.

    Techniques: Western Blot, Expressing, Quantitative RT-PCR, Transfection, Luciferase, Construct, Plasmid Preparation, Staining, Flow Cytometry